pgpB [2020-07-07 15:55:25]

phosphatidylglycerol phosphate (PGP) phosphatase , has minor undecaprenyl pyrophosphate phosphatase activity

locus: BSU_19650

pI: 10.14

mw: 22.64 kDa

protein length: 203 aa

gene length: 612 bp

function: phospholipid biosynthesis

product: phosphatidylglycerol phosphate (PGP) phosphatase

essential: no

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 2,136,913 2,137,524

The protein

Catalyzed reaction/ biological activity

• 1,2-diacyl-sn-glycero-3-phospho-(1ʼ-sn-glycero-3ʼ-phosphate) + H₂O --> 1,2-diacyl-sn-glycero-3-phospho-(1'-sn-glycerol) + phosphate (according to UniProt)

Protein family

• PA-phosphatase related phosphoesterase family (single member, according to UniProt)

Structure

• [PDB|5JKI] [Pubmed|28168443]

[SW|Localization]

• cell membrane (integral) [Pubmed|28168443]

Expression and Regulation

additional information

• the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]

Biological materials

Mutant

• MGNA-B441 (pgpB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1440 NBRP B. subtilis, Japan]
• BKE19650 ([gene|0BF97861B52722347C4BBE533E574CF548A8283E|pgpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTAACCACCTCAATT, downstream forward: _UP4_TAGAGAGAGGAAAACACAGC
• BKK19650 ([gene|0BF97861B52722347C4BBE533E574CF548A8283E|pgpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTAACCACCTCAATT, downstream forward: _UP4_TAGAGAGAGGAAAACACAGC

References

• 27528508,28168443,26883633